DNA for Beginners | Baamboozle - Baamboozle | The Most Fun Classroom Games!

0%

0 0 0

Nucleotides are made up of a sugar, phosphate, and..?

nitrogen bases

Create the complimentary strand for the DNA strand: AACGGTCCAGTCCAAGTTACG

TTGCCAGGTCAGGTTCAATGC

What holds the 2 strands of DNA together to make the "twisted ladder"

Hydrogen Bonds

Which sequence of DNA bases would pair with this partial strand ATG TGA CAG

TAC ACT GTC

In a molecule of double-stranded DNA, Adenine is always equal to

Thymine

Who took photo 51, giving the major evidence of the DNA structure?

Rosalind Franklin

The two men who established the structure of DNA by stealing important scientific evidence were:

Watson and Crick

Why do our cells need to go through DNA replication?

Every new cell produced in our bodies needs its own set of DNA.

What sugar is in DNA?

deoxyribose

The "rungs" of the DNA ladder are made of

2 nitrogen bases

Where does DNA replication take place?

Nucleus

What is the long name for DNA?

deoxyribonucleic acid

How did Rosalind Franklin's photo 51 affect the work of Watson and Crick?

provided the evidence to show the number of strands

Which 2 molecules form the sides (backbone) of the DNA ladder?

phosphate and sugar