• DNA for Beginners
     Help
  • Create the complimentary strand for the DNA strand: AACGGTCCAGTCCAAGTTACG
    TTGCCAGGTCAGGTTCAATGC
  • The two men who established the structure of DNA by stealing important scientific evidence were:
    Watson and Crick
  • The "rungs" of the DNA ladder are made of
    2 nitrogen bases
  • Unlock this slideshow and over 4 million more with Baamboozle+
    Try slideshows
    • Your experience on this site will be improved by allowing cookies.